Race: CFP

The Monist copy cover

The Monist copy cover; with a black background and blue font, it doesn't show up very well. Hopefully the inside is easier to read.

The Monist is currently looking for submissions on race, see behind the cut for full details.

Topic: This issue of The Monist will explore race both the concept and the category from a philosophical point of view. The focus will be not only on the metaphysical and epistemological issues related to racial classification, but also on the social and psychological aspects of race. What is race? What sort of category is it, ontologically speaking? Is it an empty category? If not, is it a biological kind, a social kind, or perhaps both? How is race conceptualized both scientifically and in everyday discourse? Read the rest of this entry »

CFP: Feminist Disability Studies in/and Feminist Bioethics

CALL FOR CONTRIBUTIONS

TO A SPECIAL ISSUE OF

INTERNATIONAL JOURNAL OF FEMINIST

APPROACHES TO BIOETHICS (IJFAB)

Vol. 3, no. 2, Fall, 2010

From the Margins to the Center:

Feminist Disability Studies and/in Feminist Bioethics

Guest Editor, Shelley Tremain

In recent years, work done in mainstream bioethics has been challenged by the emerging field of disability studies. A growing number of disability theorists and activists point out that the views about disability and disabled people that mainstream bioethicists have articulated on matters such as prenatal testing, stem cell research, and physician-assisted suicide incorporate significant misunderstandings about them and amount to an institutionalized form of their oppression. While some feminist bioethicists have paid greater attention to the perspectives and arguments of disabled people than other bioethicists, these perspectives and arguments are rarely made central. Feminist disability theory remains marginalized even within feminist bioethics. Read the rest of this entry »

Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here’s one that shouldn’t be missed, on Damien Carrick’s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Read the rest of this entry »