Another Science Hoax

Keith Windschuttle, editor of Australian Right magazine Quadrant, and prominent culture warrior, has been hoaxed — publishing an article arguing essentially that genetic scientists should be allowed to do anything they want without the scrutiny of the public or media, because scientists know best.

The hoaxer outed themselves to another online magaine, Crikey, and has chronicled their misdeed in the blog ‘Diary of a Hoax.’ This is delicious. Continue reading

Microchipping of HIV carriers… What next?

Here’s a link to the story.

This raises a number of interesting questions… Foremost of which being, why would this strategy be employed?

The capacity for a microchip (basically an implanted ID card) to affect behaviour in those who are reckless or wanton in spreading HIV must be quite questionable.  And this would also be dependent on a range of other supports.  The provision in and of itself makes little sense.

As the Australian national guidelines state:

for people with HIV who place others at risk, a variety of increasingly interventionist strategies may be needed, with preference being given to strategies that are least restrictive, as these will generally be the most sustainable and effective in the long term.”

This author’s statement in Time, is simply insane:

“The chip would send off a signal when infected blood comes into contact with non-infected blood so it would monitor the spread.” Continue reading

Podcast about the ‘trials’ of courtroom interpreters

How should the courtroom interpreter interpret their own role in the courtroom? And what discrepencies exist in understandings of this role, between defence and prosecution lawyers, judges, defendants, and the interpreters themselves?

This comprehensive and interesting Australian Radio National podcast may interest readers of the ‘what sorts’ blog, especially with respect to the interests of access to justice and the ability to be fully linguistically present at one’s own trial. Continue reading

Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here‘s one that shouldn’t be missed, on Damien Carrick‘s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Continue reading

China’s one child policy, a generation on

Those interested in issues pertaining to population control and family planning might like to listen to this Australian Radio National podcast, which charts the history of the one child policy in China: it’s making, and its effects. Continue reading

Knowing Thine Enemy?: a book to look out for

cover image for Enhancing Human Capacities by Julian Savulescu

cover image for Enhancing Human Capacities by Julian Savulescu et. al

Some of you — and especially philosophers on the ‘what sorts’ team — will know of a controversial Australian ex-pat ethicist who likes to provoke debate about what sorts of people there should be … No,this time it’s not Peter Singer (although Singer was his PhD supervisor), but rather Julian Savulescu of The Oxford Uehiro Centre for Practical Ethics. Savulescu’s chief interest is the use of biotechnology for what he presumptively calls ‘human enhancement.’

When he worked for the Murdoch Children’s Research Institute Savulescu wrote a piece called “In Defense of Selection for Nondisease Genes”.* As this community knows well, others have argued that it is defensible to engage in postconception selection against diseased genes, where the term diseased genes refers to:

a gene that causes a genetic disorder (e.g. cystic fibrosis) or predisposes to the development of a disease (e.g. the genetic contribution to cancer or dementia)

This argument in itself is highly contestable, given that it is reasonable to feel that a ‘diseased’ life of one with, say, cystic fibrosis — let alone one that down the line ends with cancer or dementia — is worth living… and more pertinently, that there are grave social consequences when that decision is made on others’ behalf as a matter of course. Savulescu, however, offers a far more radical thesis than this. Continue reading