CFP: Feminist Disability Studies in/and Feminist Bioethics

CALL FOR CONTRIBUTIONS

TO A SPECIAL ISSUE OF

INTERNATIONAL JOURNAL OF FEMINIST

APPROACHES TO BIOETHICS (IJFAB)

Vol. 3, no. 2, Fall, 2010

From the Margins to the Center:

Feminist Disability Studies and/in Feminist Bioethics

Guest Editor, Shelley Tremain

In recent years, work done in mainstream bioethics has been challenged by the emerging field of disability studies. A growing number of disability theorists and activists point out that the views about disability and disabled people that mainstream bioethicists have articulated on matters such as prenatal testing, stem cell research, and physician-assisted suicide incorporate significant misunderstandings about them and amount to an institutionalized form of their oppression. While some feminist bioethicists have paid greater attention to the perspectives and arguments of disabled people than other bioethicists, these perspectives and arguments are rarely made central. Feminist disability theory remains marginalized even within feminist bioethics.

Read the rest of this entry »

Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here’s one that shouldn’t be missed, on Damien Carrick’s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Read the rest of this entry »

Eugenics 2008? The deportation of Lucy Chapman

Anyone who reads the news has heard stories about killers, rapists, and suspected terrorists that have fought deportation from Canada and in many cases won or at least delayed being deported. So, who are the really BAD people that we need to keep out of this great country for fear that they will destroy the nation. Apparently 7-year-old Lucy Chapman is one of them. Read the rest of this entry »

Making babies: the next 30 years

Published online 16 July 2008 | Nature 454, 260-262 (200 8) | doi:10.1038/454260a Helen Pearson

and on this blog you find a write up about what is in the Nature article

of cause artificial womb and gene therapy are part of the list
The hotlink titled ‘medical advances’ is not linking to the Nature article but to another

Knowing Thine Enemy?: a book to look out for

cover image for Enhancing Human Capacities by Julian Savulescu

cover image for Enhancing Human Capacities by Julian Savulescu et. al

Some of you — and especially philosophers on the ‘what sorts’ team — will know of a controversial Australian ex-pat ethicist who likes to provoke debate about what sorts of people there should be … No,this time it’s not Peter Singer (although Singer was his PhD supervisor), but rather Julian Savulescu of The Oxford Uehiro Centre for Practical Ethics. Savulescu’s chief interest is the use of biotechnology for what he presumptively calls ‘human enhancement.’

When he worked for the Murdoch Children’s Research Institute Savulescu wrote a piece called “In Defense of Selection for Nondisease Genes”.* As this community knows well, others have argued that it is defensible to engage in postconception selection against diseased genes, where the term diseased genes refers to:

a gene that causes a genetic disorder (e.g. cystic fibrosis) or predisposes to the development of a disease (e.g. the genetic contribution to cancer or dementia)

This argument in itself is highly contestable, given that it is reasonable to feel that a ‘diseased’ life of one with, say, cystic fibrosis — let alone one that down the line ends with cancer or dementia — is worth living… and more pertinently, that there are grave social consequences when that decision is made on others’ behalf as a matter of course. Savulescu, however, offers a far more radical thesis than this. Read the rest of this entry »

What sorts of walks in our pageant?

As “Britain’s Missing Top Model” continues to whittle down the competitors with disabilities as they compete against each other on the BBC, it is interesting to compare this competition to the Miss Iowa and Miss USA contests in which at least one woman with a disability competed against women without disabilities.

Read the rest of this entry »

Voting for Mavericks

Just a reminder to anyone who wants to vote in the Mavericks competition that the Vocational and Rehabilitation Research Institute in Calgary is running to GET TO IT FOLKS. On the roster (Maverick #6) is our very own Leilani Muir (pictured here, some time earlier than yesterday), who blazed a maverick path by taking the Province of Alberta to court in 1995-96 for her wrongful eugenic sterilization under the Sexual Sterilization Act of Alberta. The decision in Leilani’s case paved the way for a large number of further settlements for other plaintiffs, and more than a blip of public awareness about this aspect of Alberta’s history. You can vote for three candidates in different categories (education, deinstitutionalization, and community living), and voting for Leilani is a small step to having the courage and determination behind her efforts recognized more publicly, Read the rest of this entry »

Eugenics History in 10 Minutes

Liam Dunaway’s (2007) 10-minute War on the Weak video is available on YouTube. Read the rest of this entry »

Podcast of Talks on Eugenic Sterilization in Alberta

Podcasts are available of nearly all of the talks that were given in a public conference held at the University of Alberta in Edmonton last year, “Eugenics and Sterilization in Alberta: 35 Years Later”. Eugenic sterilization was practiced in Alberta until 1972, when a new provincial government repealed the Sexual Sterilization Act of Alberta. The conference was public not only in the sense that it was “open to the public” but in that it strove to include the voices of community members who were affected by the long history of eugenic sterilization in the province of Alberta. Speakers included the Honorable David King, the MLA and cabinet minister in the provincial government who led the way in the repeal of the SSAA in 1972 and offered his own personal reflections; Claudia Malacrida, a sociologist who talked about dehumanization and sterilization in institutional contexts; and Leilani Muir and Judy Lytton, two Albertans who lived in those contexts. You can get the program from the conference, see abstracts for the talks, and listen to the podcasts, right here.

Call for Papers: WCPA in Edmonton, October 2008

Call for Papers, Western Canadian Philosophical Association
2008 Annual Meeting, Edmonton, Hosted by the University of Alberta
October 24-26th 2008 (Friday pm until Sun lunch)

Keynote Speaker: Stephen Darwall, Yale University

Details from conference organizers beneath the fold. Of special relevance for What Sorters are two things: our network team will be running a pre-conference workshop on the Friday (the conference usually starts around 6pm), including talks from the Finnish bioethicist Simo Vehmas and others still be arranged, and have also arranged with the conference organizers to hold a special stream during part of the conference on What Sorts themes. If you have something to submit as part of the regular conference, or are interested in attending the pre-conference workshop, contact me directly before the submission deadline. If there are enough What Sorts submissions that we know of in advance, we may look at extending the number of sessions we plan to have on What Sorts themes at the conference.

Read the rest of this entry »

Medical Genetics Is Not Eugenics

The Chronicle of Higher Education has just published a pair of interesting articles on eugenics, reproductive technologies, medical genetics, and human enhancement (sadly, you need a subscription to access them).

Both are quite interesting and worth reading but I found Ruth Cowan’s position, unambiguously enunciated in her title, “Medical Genetics Is Not Eugenics” somewhat one-dimensional and at times naïve, especially when it comes to her characterization of both technology and the integrity of the medical sciences that we should essentially trust because it is “science” with “good intentions.”

I think the article is important for it reminds us that that we can’t make simple comparisons whereby we collapse past with present, eugenics with medical genetics. It does analytically pay, of course, to pay attention to differences. They matter and often matter for the reasons she highlights, which I will mention in a moment. But to declare the matter closed is far too dangerous in a period when we are still struggling to understand the ethical dilemmas at the heart of many new genetic enterprises and looking to the past, for possible ethical or conceptual connections, may in fact make these more clear.

Here are a few of her basic claims:

“There is, to start with, no meaningful historical connection between the enterprise once called eugenics and the enterprise now called medical genetics.”

“Technological systems are built to achieve certain goals; those goals get hard-wired, as it were, into the components of the system. The chief goal of the eugenicists, “improvement of the race,” was never one of the goals of genetic screening — and it did not become one, even after genomic research had identified the locations of dozens of disease-causing mutations.”

“From the very beginning, the founders of medical genetics — people like Neel, Fritz Fuchs, Michael Kaback, and Robert Guthrie — viewed their basic project as the relief of human suffering, not improvement of the race. Relief of suffering might, in their view, also improve the health of races or populations or societies, but improving the health and well-being of individuals was always their primary goal.”

While I agree with her basic premise—eugenics in the past is not some carbon copy of medical genetics/genetic testing today—there are important reasons to critically engage with current forms of genetic testing through the lens of eugenics in the past. But if we are to take her claim to its logical conclusion, then we should not even bother with this critical exercise; and if we were to simply categorize these two endeavors as radically distinct and unrelated, we would lose an opportunity to cultivate a valuable and critical perspective about the ways in which genetic testing may be replicating some older eugenics logics and biases. Read the rest of this entry »

Pinker on human dignity and the President’s Council

Cognitive scientist, public intellectual, and (more importantly) inspirational member of the Luxuriant Flowing Hair Club for Scientists Steve Pinker has a piece of interest out in The New Republic, May 28th, 2008, “The Stupidity of Dignity“, which some What Sorters will find of interest. It concerns the use of the concept dignity in thinking on public policy in the realm of technology, enhancement, and human futures, and responds to the President’s Council on Bioethics recent release of a 555-page report, entitled Human Dignity and Bioethics, out in March 2008, and whose table of contents you can find here.

There will be many places on the web that you will be able to find discussions of this, in due course. Hat tip to The Neurocritic for catching my eye, who in turn picked it up from Jason Rosenhouse’s EvolutionBlog .

Hear and Now

Hear and Now is a 2007 film by Taylor Brodsky that focuses on her deaf parents’ decision, late in their lives, to undergo cochlear implant surgery, in order to gain a significant level of hearing. It won an audience award at the Sundance Film Festival last year, and debuted in the US on the HBO network last Thursday. It is playing now on the Movie Channel network in Western Canada; I watched it last night. Catch it if you can; you can check out a review of it by Shelley Gabert at FilmStew.

Why might the film matter to What Sorters? Cochlear implant surgery is controversial in the Deaf/deaf communities for a number of reasons: here are two, one more theoretical, the other more practical. First, it is often seen as a way to make deaf people normal, a technological or surgical fix to a defect. This views deafness as a problem to be solved, rather than a human variant with its own pros and cons, and privileges hearing as normal over deafness as abnormal. Second, on the practical side, it disrupts functioning Deaf communities, which communicate linguistically through sign languages, and the lives of individuals in those communities, not least of all because the surgery is often less successful than it is projected as being in terms of the hearing capacity it generates, and the ways in which the downsides are downplayed by the hearing community, including doctors and medical staff.

Two recent books of related interest to check out on some of the issues in play here are Michael Chorost’s Rebuilt: How Becoming Part Computer Made Me More Human (2005), which details Chorost’s own experiences with cochlear implants and the decision to get them; and a collection of recent essays, Read the rest of this entry »