Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here‘s one that shouldn’t be missed, on Damien Carrick‘s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Carrick asks a range of legal, genetics, and bioethics experts how we should be thinking about regulating genetic profiling, and the scope for increased discrimination that it opens, in both the commercial and familial spheres.

If you have an mp3 player, give it a listen.

NB: Image by Dollar Bin, distributed under Creative Commons license

Advertisements

Leave a Reply

Please log in using one of these methods to post your comment:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s