Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here‘s one that shouldn’t be missed, on Damien Carrick‘s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Continue reading