Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here‘s one that shouldn’t be missed, on Damien Carrick‘s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Continue reading

What sort of coverage: Amputees fight caps in coverage for prosthetics

By Dave Gram, Associated Press

SOUTH BURLINGTON, Vt. – After bone cancer forced the amputation of her right leg below the knee, Eileen Casey got even more bad news: Her insurer told her that she had spent her $10,000 lifetime coverage limit on her temporary limb and that the company wouldn’t pay for a permanent one……more here

Comment: On the one hand society promotes a body image and a social environment that seems to make legs essential (most places are still not set up for non-leg modes of movement), and on the other hand they are not willing to enable one to have the legs.
Technorati Tags: , , , , , ,