Fundamental Disability Rights Case Goes to Supreme Court of Canada

On Tuesday May 17th the Supreme Court of Canada will be asked to consider whether people with intellectual disabilities should be allowed to testify in court.  Specifically, the question before the Court is whether people with intellectual disabilities are required to demonstrate an understanding of the concept of a “promise to tell the truth” in order to be permitted to testify.

On Tuesday May 17th the Supreme Court of Canada will be asked to consider whether people with intellectual disabilities should be allowed to testify in court.  Specifically, the question before the Court is whether people with intellectual disabilities are required to demonstrate an understanding of the concept of a “promise to tell the truth” in order to be permitted to testify.

Your link text here.

Advertisements

Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here‘s one that shouldn’t be missed, on Damien Carrick‘s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Continue reading

Censoring Joy

the lesbian prototype?Celebrations last week for the legalization of same-sex marriage in California were joyous indeed. It was marked as a great triumph for couples like Del Martin and Phyllis Lyon, who have been together since 1953, and who were first to be married in California under the new law. In any situation where the press meets sexuality, however, the question of choice arises: why Martin and Lyon? What does a ‘normal’ gay marriage look like, anyway? We might optimistically think that the choices surrounding the publication of images of potentially controversial material are not spelled out in such explicit terms, but in this case, at least, we might be surprised. Interestingly, it has been from proponents of gay marriage that the most blatant censorship has come. Presumably out of fear that images of “guys in gowns” might scare off even more liberally-minded Americans, yet unsure of what gay marriage might spell for the norms and values of the state, leaders of the California gay/ lesbian community have been underscoring the importance of self-censorship at same-sex marriages. Jack, from Feministe, explains why she isn’t celebrating:

That’s right, folks: no camp here. No gender non-conformity, either. And definitely no guys in gowns.

Why? Because the marriage equality movement is largely predicated on the notion that us queers are just like “everyone else,” meaning mostly white, mostly middle-class or up, gender conforming monogamists. You know, the non-threatening queers. The rest of us should apparently find a nice closet to go hide in for a while, lest we threaten the rights that are apparently meant for the more upstanding, respectable members of the LGsomeotherlessimportantletters community….. Continue reading