Future Past: Disability, Eugenics, & Brave New Worlds

Future Past: Disability, Eugenics, & Brave New Worlds. A public symposium on the history and ongoing implications of eugenics ideologies and practices for people with disabilities.
Why do these issues matter? How can we address them in teaching and pedagogy, in policy and activism, and in art?

On November 1, 2013 at San Francisco State University, Seven Hill Conference Center from 9:00 am – 8:00 pm.
The Living Archives on Eugenics in Western Canada is co-sponsoring a conference, dinner and reception plus the screening of FIXED: The Science/Fiction of Human Enhancement. Conference organizers include: Paul K. Longmore Institute on Disability, Living Archives on Eugenics in Western Canada, and the Center for Genetics and Society.

Registration is free:  geneticsandsociety.org/futurepast

Future Past is the result of a cross-national collaboration among advocates and academics interested in gaining a deeper understanding of the long and tangled relationship between disability and eugenics, and the contemporary implications of genetic technologies to the lives and futures of people with disabilities.

Program – November 1, 2013

9:00 – 9:15: Welcome

  • Provost Sue Rossier, San Francisco State University
  • Catherine Kudlick, Director, Paul K. Longmore Institute on Disability

9:15 – 9:30: Table Introductions

9:30 – 11:30: What? Eugenics and Disability: Past and Present

Many people are unaware of the history of eugenics movements in North America, yet they are disturbingly relevant today.

Presenters:

  • Alexandra Minna Stern (moderator), Departments of Obstetrics and Gynecology, American Culture, and History at the University of Michigan.
  • Marcy Darnovsky, Center for Genetics and Society
  • Glenn SInclair, Living Archives on Eugenics in Western Canada
  • Nicola Fairbrother, Living Archives on Eugenics in Western Canada

Table Discussions

11:30 – 12:30 : Lunch

12:30 – 2:30: So What? The Consequences of Misremembering Eugenics

What are the social and ethical consequences of omitting eugenics from historical memory or misrepresenting it? What is the price of the pursuit of “human betterment” for reproductive and disability justice?

Presenters:

  • Marsha Saxton (moderator), World Institute on Disability
  • Rob WIlson, Living Archives on Eugenics in Western Canada, University of Alberta
  • Troy Duster, Warren Institute for Law and Society Policy, University of California, Berkeley
  • Rosemarie Garland-Thomson, Emory University

Table Discussions

2:30 – 3:00: Break

3:00 – 5:00: Now What? Looking Ahead to Brave New Worlds

What is being done – and what can be done – to increase public and student understanding of the legacies of eugenics through teaching, activism and art?

Presenters:

  • Milton Reynolds (moderator), Facing History and Ourselves
  • Gregor Wolbring, Living Archives on Eugenics in Western Canada, University of Calgary
  • Kate Wiley, Lick-Wilmerding High School
  • Patricia Berne, Sins Invalid

Table Discussions

5:00 – 6:30: Dinner and Reception

6:30 – 8:00 Sneak-preview screening

FIXED: The Science/FIction of Human Enhancement

Producer/DIrector Regan Brashear will answer questions

 Future Past Nov 1

Judge approves man’s sterilization

It is the first time in England and Wales a court has sanctioned a man’s sterilization. A High Court judge has sanctioned the sterilization of a man “in his best interests” in a landmark legal ruling.
The 36-year-old, from the Midlands, has learning difficulties and already has a son, born in 2010, with his girlfriend.
Justice Eleanor King ruled that a vasectomy could take place after hearing that another child could cause the man :psychological harm.”
Experts said he was capable of sexual consent but did not have the capacity to make decisions about contraception.

The entire story was released today in the BBC News and can be viewed here: http://www.bbc.co.uk/news/uk-23721893

Meet the New Eugenics, Same as the Old Eugenics

From the Center for Genetics and Society blog, by Gina Maranto, Biopolitical Times guest editor, March 4, 2013

The unfortunate truth is that discredited ideas never do die, they just rise again in slightly altered forms—witness eugenics. Despite the horrors perpetuated in its name, including forced sterilization and the Holocaust, the eugenic impulse is with us still. One of the forms it takes is schemes for “improving” offspring through the selection and manipulation of embryos.

In the last year or so, one neo-eugenic advocate in particular has been garnering media attention. He’s Julian Savulescu, holder of an array of titles, including an endowed chair and directorship of a center at the University of Oxford funded by the Uehiro Foundation on Ethics and Education.

Continue reading

A Prequel to Gattaca?

The 1997 film Gattaca, written and directed by Andrew Niccol, portrays a futuristic society where babies are genetically engineered according to parental references.  The film features a society that consists almost exclusively of such artificially built individuals, with those who are born in the archaic, natural manner occupying the fringes of this society.  In order to protect the rights of what are referred to as the “valids” and thereby keep out the inferior “invalids,” each individual’s genetic material is constantly sampled and monitored.  Every person’s DNA is stored in a database, making multiple scans and random genetic sweeps in the workplace very efficient.  The story follows an “invalid” who has a dream of becoming an astronaut, a job open only to the genetically enhanced elite.

But my intention here is not to provide a synopsis of the film, which is very good and is certainly well worth the time it takes to watch.  Rather, I wanted to Continue reading

One Child, Three Biological Parents – End of Diseases?

Last week, The Telegraph announced that within three years, it will be possible to have three biological parents for any one embryo using in-vitro fertilization.  Why would anyone pursue such a technique?  To “eradicate hereditary disease.”  You can read the full artcle below:

http://www.telegraph.co.uk/science/science-news/9025121/Babies-with-three-parents-possible-within-three-years.html

This controversial method proposes that transferring a tiny fraction of DNA from a different donor than only the parents will result in a child without mitochondria-related diseases.  (Mitochondrial diseases are often severe and incurable, including muscular dystrophy and ataxia).  Researchers believe they can wipe out such diseases within a generation.  Children would also retain DNA from both their mother and their father.  The genetic implant of a third person is described as being “as minimal as changing the batteries in a camera.”

Researchers are also placing great emphasis on needing public support, before current laws (which would prevent such an operation) become changed.  Strong opposition comes from “groups who oppose embryo research and claim genetic engineering can result in serious defects.”

What is perhaps equally interesting to the article itself is the poll available on the website.  The Telegraph asks: Continue reading

Chromosome Disorder Outreach

Thanks to Velvet Martin for posting a link to the following video from CDO; her daughter Samantha features.  What do people think of the message here?  Community building around chromosomal disorder?  A humanization of the dehumanized who “look kinda funny”?  A tacit complicity with the medicalization of human variation (via the notion of “disorder”)?  All of the above?  Something else? Continue reading

Modern Pursuit of Human Perfection talks: now captioned

In October 2008, the What Sorts Network and the “From Archives to Activism” project in that network cosponsored a public dialogue, The Modern Pursuit of Human Perfection, with three of our community partners: the Alberta Association for Community Living, the Canadian Association for Community Living, and Neighborhood Bridges. The event was held at the University of Alberta on October 23rd, 2008, and was open to the public and filmed. It formed part of a series of public events we put on that continued on Friday and Saturday, including an invited symposium at the Western Canadian Philosophical Association on Philosophy, Eugenics, and Disability in Alberta and Places North that kicked off with this talk from Dick Sobsey, director of the John Dossetor Health Ethics Centre at the University of Alberta and a leading authority on violence and disability. (We’re still in the process of moving from transcripts to captioning for these talks.)

The public dialogue began with some opening comments from our cosponsors, continued with short presentations from our community member panelists talking of their personal experiences with medicine, disability, and social services, and was rounded out by a series of interchanges between audience and panel. All videos now contain both transcripts and closed captioning (thanks to Jackie Ostrem for completing the work needed here), and the videos are also available directly on YouTube. Since the closed captioning has just been added, and will make the videos here more accessible for classroom and community use, we’re running them again on the blog in three or four chunks, the first of which is below and contains all of the short narrative stories at the core of the dialogue. Comments on the blog on any of these posts is still welcome, but we also hope that you’ll find these of interest and use down the track for individual reflection or group discussion. Each video is cut to “Youtube size”, i.e., less than roughly 10 minutes, which, apart from fitting the attention span of the Youtube generation, also packages the discussions here more aptly for classroom discussion.

Thanks to all participants: Anna Macquarrie, Bruce Uditsky, Dick Sobsey, Wendy Macdonald, Sam Sansalone, Colleen Campbell, Anne Hughson, and Simo Vehmas. And thanks to Grant Wang and Lee Ramsdell at the Arts Resource Centre at the University of Alberta for the filming and post-production work; to John Simpson for organizational assistance; and to Jackie Ostrem for the transcriptions and captioning.

Introduction (Anna Macquarrie and Bruce Uditsky)

My doctor, my child (Wendy Macdonald)

Living with trisomy 13, part I (Sam Sansalone)

Living with trisomy 13, part II (Sam Sansalone)

When disability meets social welfare (Colleen Campbell)

Regenerative Medicine

In this post, I pointed to a new technique for regrowing limbs that makes use of “Pixie Dust” to accomplish the seemingly impossible: regrowing the entire tip of a man’s finger.  It prompted the question, “Could we do more?”  To find out, watch this short video from Newsweek.  It features Shilo Harris, a man who suffered the loss of two fingers and extensive burns durring an IED explosion and a discussion of both the treatment he received and the progress that was made.

Philosophy, Eugenics & Disability in Alberta and Places North – Dick Sobsey Parts 3 & 4

On October 25, 2008, the What Sorts Network hosted a public symposium to examine, well, philosophy, eugenics, and disability in Alberta and places north.  Four speakers were featured on the panel, Dick Sobsey, Simo Vehmas, Martin Tweedale, and Rob Wilson.  This event was video recorded and over the next month we will highlight these videos on this blog.  Videos will be featured on average twice a week, roughly every Saturday and Wednesday.

To download the full description of the symposium please click here.

We began this series with the first two parts of the presentation by Dick Sobsey, titled “Varieties of Eugenics Experience in the 21st Century.”  This presentation amounts to a summary of various kinds of eugenic motivations, justifications, and practices from the 19th century to today with a good collection of anecdotes and trivia.  Parts 3 and 4 are highlighted in the videos below. Transcripts are also posted below.

Part 3

Highlights from part 3 include: criticism of Jukes as an assault upon the poor, best cement in the world, origin of the underground records for all the new york banks, continuing the Juke heritage, Dugdale’s findings, Oliver Wendell Holmes Sr. on Sterilization, measures of intelligence and the Flynn Effect, and stopping people from having children easiest through institutionalization.

Continue reading

Saving the World with Viral Eugenics

Randall Gordon, a character from Paul Chadwick's Concrete series, points his finger at the audience a la Uncle Sam with the following speech bubble "I'm completely serious, and I repeat my appeal. You, out there. Somewhere. Sexually transmitted; no undue harm; infertility. Go save the world.

Randall Gordon, a character from Paul Chadwick's Concrete series, points his finger at YOU, a la Uncle Sam, with the following speech bubble: "I'm completely serious, and I repeat my appeal. You, out there. Somewhere. Sexually transmitted; no undue harm; infertility. Go save the world."

And so a tale already fraught with controversy unleashes an ethical bombshell… Continue reading

First PGD BRCA1 baby born in UK

As the BBC has reported here, the first baby has been born in the UK whose birth was a function of preimplantation genetic diagnosis (PGD) for–or, rather, against–a gene, some of whose alleles have mutations strongly correlated with certain forms of breast and ovarian cancer. What follows are the basics, and two viewpoints on this, and a poll for you to participate in. Continue reading

The ethics of exclusion, the morality of abortion, and animals

[This post is the fourth in our new series of Thinking in Action posts, the series being devoted initially at least to discussion of talks at the Cognitive Disability conference in NYC in September.]

Here is a question from Adrienne Asch, together with a response from Jeff McMahan, following Jeff’s talk at the Cognitive Disability conference; Adrienne’s question followed directly on the heels of Naomi Scheman’s question, the subject of the previous post in this series.

[A full, unofficial transcript for this video clip, as well as a poll for you to participate in, are available beneath the fold. If you are having trouble playing the video above, the full transcript is provided at the end of the post, and you can also try Youtube directly by clicking right here, which for some will be more accessible.]

So does simply asking questions like “In virtue of what does human life have moral value and significance?” somehow express an ethics of exclusion? Asch seems to imply so, in part because it is asking us to draw a line between those that have some property, and those who lack it. Above the line are those with full moral status, and below it are The Rest, others who are thus excluded from full moral consideration, at least insofar as we consider them in and of themselves. If that is right, then even those who give very different kinds of answer to the question–such as those, like Naomi Scheman, who appeal to the relationships that people form a part of in their answers–still express this ethics of exclusion, at least at some level, even if they deliver an answer to the question that is more inclusive.

Asking the question as Asch has asked it—“Jeff, what is the purpose of this effort? If it is not the ethics of exclusion, I don’t know what it is.”—invites the personal response that McMahan gives to it. That response comes only after audience members are reminded that pro-choice views about abortion, popular with the politically liberal, express a kind of ethics of exclusion. I suspect that many of the disability theorists and activists in the room, perhaps influenced by Asch’s own work, don’t need reminding about this, at least when it comes to selective abortion on the basis of the results of genetic screening for “defects”. (See, for example, Adrienne Asch, 2003, “Disability Equality and Prenatal Testing: Contradictory of Compatible?”, Florida State University Law Review 315: 318-346–get this and thematically-related articles right here). McMahan got into this, he tells us, through thinking about the morality of abortion, and what it was about fetuses that made some people think that they should not be killed, while those same people were perfectly happy allowing all sorts of animals to be killed, and in some cases, eating them. McMahan’s answer is meant to provide an alternative to the answer that Asch herself seems to proffer. Where Asch sees an ethics of exclusion, McMahan sees the pursuit of abstract philosophical inquiry–albeit inquiry with real-world oomph–wherever it leads.

While one might see Asch and McMahan’s answer as alternatives, one need not; there is more than a grain of truth in each answer. Continue reading

Call for Contributions: Feminist Disability Studies and/in Feminist Bioethics

NOTE FROM ST: Readers of the blog may notice that I have posted this cfp to the blog several times.  Please excuse the repetition, but I am keen to get many submissions for the issue which should be pathbreaking.

 

CALL FOR CONTRIBUTIONS

TO A SPECIAL ISSUE OF

 

INTERNATIONAL JOURNAL OF FEMINIST

APPROACHES TO BIOETHICS (IJFAB)

Vol. 3, no. 2, Fall, 2010        

 

From the Margins to the Center:

Feminist Disability Studies and/in Feminist Bioethics

 

Guest Editor,  Shelley Tremain

 

In recent years, work done in mainstream bioethics has been challenged by the emerging field of disability studies.  A growing number of disability theorists and activists point out that the views about disability and disabled people that mainstream bioethicists have articulated on matters such as prenatal testing, stem cell research, and physician-assisted suicide incorporate significant misunderstandings about them and amount to an institutionalized form of their oppression. 

 

While some feminist bioethicists have paid greater attention to the perspectives and arguments of disabled people than other bioethicists, these perspectives and arguments are rarely made central.  Feminist disability theory remains marginalized even within feminist bioethics.  This issue of IJFAB will go some distance to move feminist disability studies from the margins to the center of feminist bioethics by highlighting the contributions to and interventions in bioethics that feminist disability studies is uniquely situated to make.

 

The guest editor seeks contributions to the issue on any topic related to feminist disability studies and bioethics, including (but not limited to): 

Continue reading

The Modern Pursuit of Human Perfection: Defining Who is Worthy of Life

The What Sorts Network, in conjunction with the Values and Ethics Task Force of the Canadian Association for Community Living (CACL) and the Alberta Association for Community Living (AACL), are pleased to announce a public dialogue on bioethics, medical ethics and the implications for people with disabilities. Details below, and in the poster, which you can download. Please pass the word along to any who may be interested. The public dialogue will kick off three days of jointly organized activities, including a free full day workshop, Families and Memory, on Friday 24th October, and a special invited session at the Western Canadian Philosophical Association: “Philosophy, Eugenics, Disability in Alberta and Places North” on Saturday 25th October. Further details shortly on the What Sorts blog, and at the What Sorts website. (Free registration for Families and Memory now open at the website.)

When: Thursday, October 23, 2008, 7-9pm

Where: ETLC 1-013, The Suncor Lecture Theatre, University of Alberta, Edmonton

Contact: Matt Mandrusiak, AACL, 780-451-3055, ext.226

Click here to download poster

Text of the poster beneath the fold. Come on out and make your voice heard!!!! Continue reading

CFP: Special issue on Feminist Disability Studies and/in Feminist Bioethics

CALL FOR CONTRIBUTIONS TO A SPECIAL ISSUE OF 

INTERNATIONAL JOURNAL OF FEMINIST APPROACHES TO BIOETHICS (IJFAB)

Vol. 3, no. 2, Fall, 2010         

 

From the Margins to the Center:

Feminist Disability Studies and/in Feminist Bioethics

 

Guest Editor,  Shelley Tremain

 

In recent years, work done in mainstream bioethics has been challenged by the emerging field of disability studies.  A growing number of disability theorists and activists point out that the views about disability and disabled people that mainstream bioethicists have articulated on matters such as prenatal testing, stem cell research, and physician-assisted suicide incorporate significant misunderstandings about them and amount to an institutionalized form of their oppression.  While some feminist bioethicists have paid greater attention to the perspectives and arguments of disabled people than other bioethicists, these perspectives and arguments are rarely made central.  Feminist disability theory remains marginalized even within feminist bioethics. 

 

This issue of IJFAB will go some distance to move feminist disability studies from the margins to the center of feminist bioethics by highlighting the contributions to and interventions in bioethics that feminist disability studies is uniquely situated to make.  The guest editor seeks contributions to the issue on any topic related to feminist disability studies and bioethics, including (but not limited to): Continue reading

Autism spectrum research and disability language alternatives

Bryce Huebner, a superstarpostdoctoralphilosophygraduate currently working in Marc Hauser’s lab at Harvard, recently sent me the following query. Bryce is writing up descriptions of research on autism / autism spectrum disorder and theory of mind (ToM), research that explores differences between experimental subject populations (you know, controlled studies and all that), often different populations of children. He writes:

I am really struggling with the sort of language to use in discussing some of the developmental data on mental state ascriptions. Here’s my problem. I want to try to avoid ableist language in discussing ToM. But I’m not sure how to discuss the similar capacities that emerge for both ‘normally developing’ children and ‘developmentally disabled’ children in contrasting these capacities with the lack of one sort of ToM that we see in children with autism spectrum disorder. Do you have any suggestions about how to avoid the use of terms like ‘developmentally disabled’ in this case?

My short answer was that Continue reading

Medical Humanities: Health and Disease in Culture: CFP

Medical Humanities: Health and Disease in Culture
POPULAR CULTURE AND AMERICAN CULTURE ASSOCIATIONS
NATIONAL CONFERENCE
New Orleans Marriott, New Orleans, Louisiana
April 8-April 11, 2009

The “Medical Humanities: Health and Disease in Culture” PCA/ACA area examines a wide variety of topics related to the experiences of human beings pursuing health and living with illness. Interdisciplinary proposals representing humanities and the arts (e.g., literature, history, film, visual arts) or social sciences (e.g., anthropology, cultural studies, sociology) perspectives through historical or contemporary contexts are welcome. This area emphasizes the pursuit of humane health care and the exploration of the social and cultural contexts in which health care is delivered for individuals or specific groups. Subject areas might include: Continue reading

Genetic profiling and the Law

Genome sign at Mission Bay, San Fransisco. The sign reads "Human Genome GCCAAAGTATACTATTTCAGCCAACAT" etc. for several lines. It is white bold text on a black backgroundI never seem to stop plugging Radio National podcasts, but here‘s one that shouldn’t be missed, on Damien Carrick‘s Law Report, about genetic profiling. The program looks at the likely prospect that within the next ten years it will be possible to purchase a full genetic profile relatively cheaply (i.e., for around $1000).

Continue reading

Knowing Thine Enemy?: a book to look out for

cover image for Enhancing Human Capacities by Julian Savulescu

cover image for Enhancing Human Capacities by Julian Savulescu et. al

Some of you — and especially philosophers on the ‘what sorts’ team — will know of a controversial Australian ex-pat ethicist who likes to provoke debate about what sorts of people there should be … No,this time it’s not Peter Singer (although Singer was his PhD supervisor), but rather Julian Savulescu of The Oxford Uehiro Centre for Practical Ethics. Savulescu’s chief interest is the use of biotechnology for what he presumptively calls ‘human enhancement.’

When he worked for the Murdoch Children’s Research Institute Savulescu wrote a piece called “In Defense of Selection for Nondisease Genes”.* As this community knows well, others have argued that it is defensible to engage in postconception selection against diseased genes, where the term diseased genes refers to:

a gene that causes a genetic disorder (e.g. cystic fibrosis) or predisposes to the development of a disease (e.g. the genetic contribution to cancer or dementia)

This argument in itself is highly contestable, given that it is reasonable to feel that a ‘diseased’ life of one with, say, cystic fibrosis — let alone one that down the line ends with cancer or dementia — is worth living… and more pertinently, that there are grave social consequences when that decision is made on others’ behalf as a matter of course. Savulescu, however, offers a far more radical thesis than this. Continue reading